ID: 1059967290_1059967300

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1059967290 1059967300
Species Human (GRCh38) Human (GRCh38)
Location 9:119627725-119627747 9:119627768-119627790
Sequence CCCCTAGGACTGTGCACATGGCC TGATTTTCTTCCTACCTCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 19, 3: 104, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!