ID: 1060126610_1060126611

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1060126610 1060126611
Species Human (GRCh38) Human (GRCh38)
Location 9:121053714-121053736 9:121053728-121053750
Sequence CCGTGTGCTTGGAGGAGAGAGAG GAGAGAGAGCAAAGTGAGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 35, 3: 192, 4: 1149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!