ID: 1060154657_1060154662

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1060154657 1060154662
Species Human (GRCh38) Human (GRCh38)
Location 9:121310888-121310910 9:121310924-121310946
Sequence CCTGGTCTGATCAGGGACTTGGG ACAAATGCATAGATGCAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 177} {0: 1, 1: 0, 2: 0, 3: 16, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!