ID: 1060155097_1060155104

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1060155097 1060155104
Species Human (GRCh38) Human (GRCh38)
Location 9:121313995-121314017 9:121314035-121314057
Sequence CCAACCGCAAGCTGGCCAAGCTC ATGCACTGTCTGCCTGGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127} {0: 1, 1: 1, 2: 5, 3: 18, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!