ID: 1060187670_1060187679

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1060187670 1060187679
Species Human (GRCh38) Human (GRCh38)
Location 9:121573888-121573910 9:121573912-121573934
Sequence CCACCTGGAGGCCCCTCCCTGTG CTGTGGAAAATCCTCTCTCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!