ID: 1060187938_1060187945

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1060187938 1060187945
Species Human (GRCh38) Human (GRCh38)
Location 9:121575219-121575241 9:121575264-121575286
Sequence CCTGGGCTTCTATCTGCTGCGCC CCAGTTGATTCTCAGAGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!