ID: 1060208899_1060208910

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1060208899 1060208910
Species Human (GRCh38) Human (GRCh38)
Location 9:121698862-121698884 9:121698901-121698923
Sequence CCAGGTGGGTGTGGGGGGTGTGA CAAGCTCGGAGGCGGCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 428} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!