ID: 1060209016_1060209031

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1060209016 1060209031
Species Human (GRCh38) Human (GRCh38)
Location 9:121699207-121699229 9:121699238-121699260
Sequence CCGGCCCGCCCTCGGCCGCGCGG CAAGGGTGCGGGTCCCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 43, 4: 385} {0: 1, 1: 0, 2: 1, 3: 6, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!