ID: 1060210192_1060210201

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1060210192 1060210201
Species Human (GRCh38) Human (GRCh38)
Location 9:121705740-121705762 9:121705764-121705786
Sequence CCAGGCAGAGCCCAGGCCCAGGT CCAGGCCTGACAGGTGCCATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 72, 4: 585} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!