ID: 1060211339_1060211345

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1060211339 1060211345
Species Human (GRCh38) Human (GRCh38)
Location 9:121712361-121712383 9:121712383-121712405
Sequence CCCTCTTTTCTGGCAGCCCAAAG GGGAGCAATGCTTATGCAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!