ID: 1060220640_1060220648

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1060220640 1060220648
Species Human (GRCh38) Human (GRCh38)
Location 9:121762423-121762445 9:121762454-121762476
Sequence CCTGGAGGTCGCCTGCTGGTCAG CCTCAGGCCACATGATCCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 24, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!