ID: 1060230434_1060230440

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1060230434 1060230440
Species Human (GRCh38) Human (GRCh38)
Location 9:121821612-121821634 9:121821663-121821685
Sequence CCTGGGGATACAGATGGAGACAA GCTCCCCTGACCCTGGCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 228} {0: 1, 1: 0, 2: 7, 3: 37, 4: 428}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!