ID: 1060271688_1060271689

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1060271688 1060271689
Species Human (GRCh38) Human (GRCh38)
Location 9:122147552-122147574 9:122147585-122147607
Sequence CCTTCTGTTCTTTAATTAGCTAA ACAAACCTGCACATGCTAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!