ID: 1060280086_1060280088

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1060280086 1060280088
Species Human (GRCh38) Human (GRCh38)
Location 9:122209802-122209824 9:122209816-122209838
Sequence CCTGAAACCAGTTTCATCTCTGC CATCTCTGCCACTTACCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 245} {0: 1, 1: 0, 2: 3, 3: 48, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!