ID: 1060280887_1060280889

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1060280887 1060280889
Species Human (GRCh38) Human (GRCh38)
Location 9:122214561-122214583 9:122214593-122214615
Sequence CCGCTTAGTACTGGACACTTCTT GACCACGTCTTACAGCCCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!