ID: 1060355916_1060355918

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1060355916 1060355918
Species Human (GRCh38) Human (GRCh38)
Location 9:122906759-122906781 9:122906805-122906827
Sequence CCACATCGAAGACGTTTCTTCCA CTCTTTATGAAACATATGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 19, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!