ID: 1060358337_1060358348

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1060358337 1060358348
Species Human (GRCh38) Human (GRCh38)
Location 9:122931452-122931474 9:122931481-122931503
Sequence CCGCCGTCAGGATCCGGCACCGC CTCCGGCCCCTCGGGGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51} {0: 1, 1: 0, 2: 4, 3: 42, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!