ID: 1060376393_1060376395

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1060376393 1060376395
Species Human (GRCh38) Human (GRCh38)
Location 9:123118362-123118384 9:123118381-123118403
Sequence CCTGCATGCAGACACCTTTTGTC TGTCCAGTGCTGAAACTGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!