ID: 1060398385_1060398395

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1060398385 1060398395
Species Human (GRCh38) Human (GRCh38)
Location 9:123332534-123332556 9:123332553-123332575
Sequence CCAGTGGTGTGCTGGTAAACTGC CTGCTGGGGGAAGGTGAGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 6, 3: 142, 4: 1172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!