ID: 1060407632_1060407646

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1060407632 1060407646
Species Human (GRCh38) Human (GRCh38)
Location 9:123380790-123380812 9:123380823-123380845
Sequence CCAAGACCCCCTGGTCCCCAGAT CAGAATCAACTGAAGTTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 269} {0: 1, 1: 0, 2: 2, 3: 29, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!