ID: 1060460729_1060460738

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1060460729 1060460738
Species Human (GRCh38) Human (GRCh38)
Location 9:123852064-123852086 9:123852115-123852137
Sequence CCTGCTGGCCCCCTTTTAAACAA TGTCCCGCCATTACACTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!