ID: 1060460731_1060460738

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1060460731 1060460738
Species Human (GRCh38) Human (GRCh38)
Location 9:123852073-123852095 9:123852115-123852137
Sequence CCCCTTTTAAACAATCAGTGTCT TGTCCCGCCATTACACTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 284} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!