ID: 1060460732_1060460743

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1060460732 1060460743
Species Human (GRCh38) Human (GRCh38)
Location 9:123852074-123852096 9:123852126-123852148
Sequence CCCTTTTAAACAATCAGTGTCTT TACACTCTGGGGAAGAGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 378} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!