ID: 1060468671_1060468689

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1060468671 1060468689
Species Human (GRCh38) Human (GRCh38)
Location 9:123929957-123929979 9:123930004-123930026
Sequence CCGCCCGCCCGCGGCCGACCGGC CTTCCTCCCTTCCCTCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 324} {0: 1, 1: 1, 2: 5, 3: 71, 4: 639}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!