ID: 1060479946_1060479959

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1060479946 1060479959
Species Human (GRCh38) Human (GRCh38)
Location 9:124012092-124012114 9:124012142-124012164
Sequence CCTTGTGACCCTGGCTTTGGCGC TGCCCCTGCGCCTCGGCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 145} {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!