ID: 1060509476_1060509486

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1060509476 1060509486
Species Human (GRCh38) Human (GRCh38)
Location 9:124221664-124221686 9:124221704-124221726
Sequence CCACTTACAGAGTTTTTATCCTA CCCTGAGGGCATGTCACAGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 34, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!