ID: 1060514639_1060514648

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1060514639 1060514648
Species Human (GRCh38) Human (GRCh38)
Location 9:124258123-124258145 9:124258136-124258158
Sequence CCGCGGCCCGGAGAAGGGCGGGG AAGGGCGGGGGCCGGGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 290} {0: 1, 1: 0, 2: 1, 3: 90, 4: 915}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!