ID: 1060517941_1060517952

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1060517941 1060517952
Species Human (GRCh38) Human (GRCh38)
Location 9:124277479-124277501 9:124277500-124277522
Sequence CCATCCCACCACCTTCTCCTACC CCCTTTCCTGCTGGGTGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 108, 4: 1109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!