ID: 1060524936_1060524943

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1060524936 1060524943
Species Human (GRCh38) Human (GRCh38)
Location 9:124315199-124315221 9:124315215-124315237
Sequence CCCAGGGAAACCCGCTTCCTGGG TCCTGGGCAGGCCTCACAGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!