ID: 1060544777_1060544782

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1060544777 1060544782
Species Human (GRCh38) Human (GRCh38)
Location 9:124453441-124453463 9:124453454-124453476
Sequence CCTGGTGCTGGGCCAGGATCAGG CAGGATCAGGACTCTCTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 489} {0: 1, 1: 0, 2: 1, 3: 21, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!