ID: 1060548671_1060548679

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1060548671 1060548679
Species Human (GRCh38) Human (GRCh38)
Location 9:124475247-124475269 9:124475274-124475296
Sequence CCCTGGCCTGCTAAATGCCACAG TCCTCCGCAGGCGGGCACGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 175} {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!