ID: 1060552820_1060552833

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1060552820 1060552833
Species Human (GRCh38) Human (GRCh38)
Location 9:124493663-124493685 9:124493707-124493729
Sequence CCCCGGGCCTACGCAGAGCTCTC GTCCCACCTGGCCTGAGGTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!