ID: 1060552821_1060552829

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1060552821 1060552829
Species Human (GRCh38) Human (GRCh38)
Location 9:124493664-124493686 9:124493682-124493704
Sequence CCCGGGCCTACGCAGAGCTCTCA TCTCAGGCTCAGGAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 175} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!