ID: 1060583447_1060583452

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1060583447 1060583452
Species Human (GRCh38) Human (GRCh38)
Location 9:124771324-124771346 9:124771341-124771363
Sequence CCCCTGACGTCACACGCCGCTGC CGCTGCCGCGCAAGGCCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 55} {0: 1, 1: 0, 2: 0, 3: 13, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!