ID: 1060601768_1060601775

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1060601768 1060601775
Species Human (GRCh38) Human (GRCh38)
Location 9:124882810-124882832 9:124882836-124882858
Sequence CCCTCTGTGTTGACATGAGTGCC GCGCTGCCTATCCCTTCCCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!