ID: 1060643857_1060643868

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1060643857 1060643868
Species Human (GRCh38) Human (GRCh38)
Location 9:125261765-125261787 9:125261809-125261831
Sequence CCCAGAGGCCCCCGCGGCGCTGC CAGCGCCGCTGCAGGACGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 202} {0: 1, 1: 0, 2: 1, 3: 13, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!