ID: 1060643862_1060643870

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1060643862 1060643870
Species Human (GRCh38) Human (GRCh38)
Location 9:125261776-125261798 9:125261820-125261842
Sequence CCGCGGCGCTGCGCACGCGCGCT CAGGACGCAGGGAAGCCAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 96} {0: 1, 1: 0, 2: 2, 3: 15, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!