ID: 1060647873_1060647879 |
View in Genome Browser |
Spacer: 11 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1060647873 | 1060647879 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 9:125297561-125297583 | 9:125297595-125297617 |
Sequence | CCTGTTCAAGGAACAGCAAGAAG | GGAGCTGTGTGAACTAGGGTGGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 3, 2: 15, 3: 51, 4: 282} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |