ID: 1060647873_1060647879

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1060647873 1060647879
Species Human (GRCh38) Human (GRCh38)
Location 9:125297561-125297583 9:125297595-125297617
Sequence CCTGTTCAAGGAACAGCAAGAAG GGAGCTGTGTGAACTAGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 15, 3: 51, 4: 282} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!