ID: 1060674322_1060674337 |
View in Genome Browser |
Spacer: 22 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1060674322 | 1060674337 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 9:125498817-125498839 | 9:125498862-125498884 |
| Sequence | CCCTCCCCACTCTCCTTCCCTTT | AGCCAACATACATCTCCTCGAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 4, 2: 27, 3: 344, 4: 2756} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||