ID: 1060703179_1060703182

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1060703179 1060703182
Species Human (GRCh38) Human (GRCh38)
Location 9:125777445-125777467 9:125777468-125777490
Sequence CCCTGGGTTCAAGCAATTCTCCT GCCTCAGCCTCCCAAGTAGCTGG
Strand - +
Off-target summary {0: 474, 1: 1625, 2: 3673, 3: 6354, 4: 7131} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!