ID: 1060703180_1060703189

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1060703180 1060703189
Species Human (GRCh38) Human (GRCh38)
Location 9:125777446-125777468 9:125777496-125777518
Sequence CCTGGGTTCAAGCAATTCTCCTG CAGGTGCAAGCTGCCGTGCCTGG
Strand - +
Off-target summary {0: 30582, 1: 98870, 2: 203067, 3: 190538, 4: 143094} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!