ID: 1060720313_1060720320

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1060720313 1060720320
Species Human (GRCh38) Human (GRCh38)
Location 9:125972198-125972220 9:125972236-125972258
Sequence CCTGCTTCCGTCTGGGCGCCACC AGCCACACCTCACGGCCAAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!