ID: 1060723685_1060723699

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1060723685 1060723699
Species Human (GRCh38) Human (GRCh38)
Location 9:125994203-125994225 9:125994247-125994269
Sequence CCTCCATCCTGCTCTTAGCTCTG AGAGGAGGGAACAGGCCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 41, 4: 390} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!