ID: 1060723760_1060723763

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1060723760 1060723763
Species Human (GRCh38) Human (GRCh38)
Location 9:125994526-125994548 9:125994541-125994563
Sequence CCTGGATGCCTGCATTTGGCCAC TTGGCCACATGCGCAAGACAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!