ID: 1060732857_1060732863

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1060732857 1060732863
Species Human (GRCh38) Human (GRCh38)
Location 9:126049159-126049181 9:126049175-126049197
Sequence CCGCTGACCCTGCTCCCTGGACT CTGGACTTAACGAGGTGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 433} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!