ID: 1060736199_1060736205

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1060736199 1060736205
Species Human (GRCh38) Human (GRCh38)
Location 9:126067947-126067969 9:126067960-126067982
Sequence CCAGCCAATTAAACAGAGCAAGG CAGAGCAAGGAGAGGGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 345} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!