ID: 1060736396_1060736403

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1060736396 1060736403
Species Human (GRCh38) Human (GRCh38)
Location 9:126069074-126069096 9:126069110-126069132
Sequence CCATTTGCCATCTTTGTGGCCTT CCCTCCCCGAAGGACAACAGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!