ID: 1060743838_1060743843

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1060743838 1060743843
Species Human (GRCh38) Human (GRCh38)
Location 9:126116987-126117009 9:126117017-126117039
Sequence CCTGAAAGGGTTTTCCCTTTAGA CAGGCTTAAGACTCTGCATTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 977}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!