ID: 1060756080_1060756084

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1060756080 1060756084
Species Human (GRCh38) Human (GRCh38)
Location 9:126214950-126214972 9:126214979-126215001
Sequence CCTGGTTTCCCTCGTACCTCTCT CTGCTCCCTGAACCCTTTGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!