ID: 1060811699_1060811703

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1060811699 1060811703
Species Human (GRCh38) Human (GRCh38)
Location 9:126614137-126614159 9:126614150-126614172
Sequence CCCCGCGGCTCCGTCTGCAGCAG TCTGCAGCAGCCGCCGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 173} {0: 1, 1: 1, 2: 7, 3: 55, 4: 475}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!